If you have been reading about AEDG and want a single page that covers the useful parts, this is it: definitions, context, how it is studied, and the questions that come up repeatedly.
Updated 2026-03-02. Numbers and descriptions here follow the published literature rather than marketing material.
Storage practice centres on limiting moisture, oxygen, and repeated temperature cycling. Freeze-dried powder is generally held desiccated at minus twenty degrees Celsius or colder and protected from light. Reconstituted solutions are markedly less stable, and the aspartate-glycine junction is prone to succinimide formation at neutral to mildly alkaline pH. Portioning material into single-use aliquots reduces degradation compared with repeated freeze-thaw cycles. Stability data specific to this tetrapeptide remain scarce, so most handling guidance is extrapolated from general peptide chemistry rather than measured directly.
Documentation accompanying research peptides usually includes a certificate of analysis listing the batch number, purity figure, and test methods applied. Buyers comparing suppliers should check whether the reported purity refers to chromatographic area or to a mass-balance calculation, because the two are not equivalent. Counter-ion content, residual solvents, and water content are sometimes omitted from such certificates even though they affect the actual peptide mass present. Independent verification through a second laboratory is the most direct way to confirm that a supplied material matches its label.
The published literature is dominated by a small number of research groups, much of it in Russian-language journals, and independent replication outside those groups is limited. Studies are typically small, use cultured cells or rodent models, and report endpoints that differ between papers, which makes comparison difficult. Large randomised human trials have not appeared in the indexed literature. Questions about absorption, distribution and clearance are therefore still treated as open in reviews that mention the compound.
Epitalon is a synthetic tetrapeptide with the sequence alanine–glutamate–aspartate–glycine, commonly abbreviated AEDG. Its design traces to epithalamin, a peptide fraction prepared from bovine pineal gland extracts that researchers in Saint Petersburg began investigating in the 1970s. The compound has a molecular formula of C14H22N4O9 and a nominal molecular mass near 390 daltons. It holds no approved drug status in the United States or the European Union, and material sold under this name is generally offered as a research chemical rather than a finished pharmaceutical product.
Proposed mechanisms centre on cell-culture observations rather than a defined receptor interaction. Several reports describe increased expression of the telomerase catalytic subunit after exposure of cultured human cells, and the authors attributed the effect to short peptide fragments entering the nucleus and influencing gene transcription. No receptor for the tetrapeptide has been identified, and the free peptide is expected to be degraded rapidly by plasma peptidases. Whether any measurable fraction reaches intact tissues after administration remains an unresolved question rather than an established finding.
| Property | Value | Notes |
|---|---|---|
| Appearance | White to off-white powder | Freeze-dried solid |
| Solubility class | Freely soluble in water | Aqueous buffers also suitable |
| Typical storage temperature | Minus 20 degrees Celsius or colder | Desiccated and light protected |
| Typical analytical method | RP-HPLC with UV detection | 214 nm on C18 column |
| Identity confirmation | Electrospray mass spectrometry | Sequence verified separately |
No pharmacopoeial monograph exists for this peptide, so quality rests on the supplier's internal specifications and on whatever independent testing a purchaser arranges. Certificates of analysis differ widely in which tests they report and in the limits applied. The counter-ion introduced during purification, commonly acetate or trifluoroacetate, changes the net peptide content of a given mass of powder, so two samples of equal weight may not contain equal amounts of the active sequence. Third-party laboratories can verify purity, identity, residual solvents, and counter-ion content for a fee, which makes documentation more informative than labelling.
Verification of a sample usually begins with reversed-phase high-performance liquid chromatography, which resolves the peptide from truncated sequences and other impurities and expresses purity as a percentage of total peak area. Mass spectrometry by electrospray ionisation or matrix-assisted laser desorption supplies an independent check, because the measured mass can be compared against the theoretical value for AEDG. Amino acid analysis or tandem mass spectrometry sequencing can confirm residue order. Each of these methods answers a different question: a purity figure does not establish identity, and an identity match does not establish how much of the material is intact peptide.
In its supplied form epitalon is a white to off-white powder, usually lyophilized and often hygroscopic. It dissolves readily in water and in aqueous buffers, and it is commonly handled as the acetate or trifluoroacetate salt to improve stability during purification and drying. The amide backbone is labile in aqueous media, so solutions are less durable than the dry solid. Handling notes in the chemical literature therefore emphasize keeping the powder dry, cool and shielded from light until it is dissolved.
Epitalon is a synthetic tetrapeptide whose sequence is alanine-glutamate-aspartate-glycine, written in single-letter code as AEDG. The four residues are joined by three peptide bonds, giving a linear backbone with no branching and no disulfide bridges. Its calculated molecular mass for the free form is approximately 390.3 daltons, a figure that rises when the compound is supplied as an acetate or trifluoroacetate salt. Because the chain is short, the molecule is defined entirely by its residue order rather than by any folded three-dimensional structure.
The compound is described in the literature as a derivative of epithalamin, a preparation obtained from bovine pineal tissue. Work on this peptide family was carried out mainly by a research group in Saint Petersburg beginning in the 1980s, and the substance was later registered for clinical use in Russia under the name Epitalon. Outside that region it is generally treated as a research chemical rather than an approved medicine. Statements about its biological activity rest on a relatively small number of studies, and independent replication remains limited.
Humans exhibit a variety of abilities. This includes an ability of emotional Hedonic Adaptation, an idea suggesting that beauty, fame and money do not generally have lasting effects on happiness (this effect has also been called the Hedonic treadmill). In this vein, some research has suggested that only recent events, meaning those that occurred within the last 3 months, affect happiness levels. The tendency to adapt, and therefore return to an earlier level of happiness, is illustrated by studies showing lottery winners are no happier in the years after they've won. Other studies have shown paraplegics are nearly as happy as control groups that are not paralyzed, after equally few years. Daniel Kahneman explains: "they are not paraplegic full time... It has to do with allocation of attention". Thus, contrary to our impact biases, lotteries and paraplegia do not change experiences to as great a degree as we would believe. However, in a newer study (2007), winning a medium-sized lottery prize had a lasting mental wellbeing effect of 1.4 GHQ points on Britons even two years after the event. Moreover, adaptation can be a very slow and incomplete process. Distracting life changes such as the death of a spouse or losing one's job can show measurable changes in happiness levels for several years. Even the "adapted" paraplegics mentioned above did ultimately report lower levels of pleasure (again, they were happier than one would expect, but not fully adapted).
Solid phase microextraction, or SPME, is a solid-phase extraction sampling technique that involves the use of a fiber coated with an extracting phase, that can be a liquid (polymer) or a solid (sorbent), which extracts different kinds of analytes (including both volatile and non-volatile) from different kinds of media, that can be in liquid or gas phase. The quantity of analyte extracted by the fibre is proportional to its concentration in the sample as long as equilibrium is reached or, in case of short time pre-equilibrium, with help of convection or agitation.
=== Evolutionary biology === Since DNA is an informative macromolecule in terms of transmission from one generation to another, DNA sequencing is used in evolutionary biology to study how different organisms are related and how they evolved. In February 2021, scientists reported, for the first time, the sequencing of DNA from animal remains, a mammoth in this instance, over a million years old, the oldest DNA sequenced to date.
Neo fends off hundreds of these Smiths and escapes. Later, he, Morpheus and Trinity steal the Keymaker from his keeper, the Merovingian. During this time, Neo stays behind to fight off the Merovingian's men and becomes separated from the others, being trapped in the Merovingian's mansion five hundred miles away in the mountains. He flies off to help them and only just arrives in time to save Morpheus and the Keymaker from two agents crashing two trucks together. The Keymaker explains that two power stations elsewhere in the Matrix must be disabled in a short time window to successfully disable the security system of a building where the door to the Source will appear, allowing Neo to reach it. This task is accomplished, but the Keymaker is killed, a hovercraft is destroyed and Trinity is jeopardized by the agents of the Matrix, illustrating a vision that Neo has seen earlier in his dreams. Entering the door, Neo finds himself confronted by the Architect, a program which created and designed the Matrix and also ensures its constant stability. The Architect presents Neo with a radically different explanation of his origins and purpose, claiming that Neo is actually the sixth "One". He goes on to say that Zion has been destroyed by the machines five times before; faced with the dilemma of allowing humanity to be destroyed or allowing the machines' preferred status quo to be reconstructed, Neo's five predecessors have helped reload or restart the Matrix, before being allowed to rebuild Zion with a handful of freed humans.
== History == EFLM was created from the merger of two precursor organisations, The Federation of European Societies of Clinical Chemistry (FESCC), (a European representative of the International Federation of Clinical Chemistry and Laboratory Medicine, IFCC) and the European Community Confederation of Clinical Chemistry (EC4) at the EuroMedlab meeting in Amsterdam in 2007. Both precursor organizations arose in the 1970s. The increasing overlap between the European Union, represented by EC4 and FESCC, representing geographical Europe, meant that merger was appropriate.
Sources: en.wikipedia.org
=== Chemi-ionization === Chemi-ionization is the formation of an ion through the reaction of a gas phase atom or molecule with an atom or molecule in an excited state. Chemi-ionization can be represented by
CTCCAACATCAAGGAAGATGGCATTTCTAG (sequence source: US FDA ETEPLIRSEN BRIEFING DOCUMENT NDA 206488), 30-mer, 20% G, 43% CG, Predicted Tm: 88.9 °C at 10 μM oligo. Oligo complement CTAGAAATGCCATCTTCCTTGATGTTGGAG DMD-001 Exon 51, ENST00000357033.8 in Ensembl.org, RNA target site marked. Given that the target site is within an exon, this is likely blocking binding of an exonic splice enhancer protein and so altering splicing by interfering with splice regulation. CTCCTACTCAGACTGTTACTCTGGTGACACAACCTGTGGTTACTAAGGAAACTGCCATCT CCAAA[CTAGAAATGCCATCTTCCTTGATGTTGGAG]GTACCTGCTCTGGCAGATTTCAACC GGGCTTGGACAGAACTTACCGACTGGCTTTCTCTGCTTGATCAAGTTATAAAATCACAGA GGGTGATGGTGGGTGACCTTGAGGATATCAACGAGATGATCATCAAGCAGAAG
2 March – Bertie O'Brien, 71, Gaelic footballer and hurler (St. Finbarr's, Cork senior teams). 3 March Camille Souter, 93, artist. Rita O'Hare, 80, Republican activist. 5 March – Maurice Scully, 70, poet. 10 March – Niall Brophy, 87, rugby union player (Leinster, national team, Lions). 12 March – Liam Kearns, 61, Gaelic footballer (Austin Stacks, Kerry senior team) and manager (Limerick, Laois, Tipperary, Offaly). 13 March – Tom Ryan, 81, hurler (Killenaule, Éire Óg, James Stephens, Tipperary senior team). 22 March – Marcus Wilson, 91, Gaelic footballer (St. Vincent's, Dublin senior teams). 25 March – Ger Glavin, 66, hurler (Midleton) and Gaelic footballer (Ballincollig, Imokilly, Cork senior team). 28 March – Jimmy Gray, 93, Gaelic footballer and hurler (Na Fianna, Dublin senior teams). 31 March – Harry Cassidy, 92, Gaelic footballer and manager (Bellaghy, Derry senior team). Born in Northern Ireland.
== Businesses and organizations == Rainforest Partnership, an environmental organization based in Austin, Texas RallyPoint, a social network for the US military Reform Party (Singapore), an opposition party in Singapore led by Kenneth Jeyaretnam Republic Polytechnic, a polytechnic in Singapore Rheinische Post, a German newspaper Rhône-Poulenc, a former French chemical company Royal Society of Portrait Painters (London), with membership indicated RP Roma Party (Romska partija), a political party in Serbia Welfare Party, or Refah Partisi, in Turkey Chautauqua Airlines, the IATA airline designator RP
1908 saw a boom in the use of radioactive water for therapeutic purposes. The discovery of springs in Oberschlema and Bad Brambach paved the way for the establishment of radium spas, which relied on the healing properties of radium. During the cures, people bathed in radium water, drank cures with radium water, and inhaled radon in emanatoriums. The baths were visited by tens of thousands of people every year, hoping for hormesis. To this day, therapeutic applications are carried out in spas and healing tunnels. The natural release of radon from the ground is used. According to the German Spa Association, the activity in water must be at least 666 Bq/liter. The requirement for inhalation treatments is at least 37,000 Bq/m3 of air. This form of therapy is not scientifically accepted and the potential risk of radiation exposure is criticized. The equivalent dose of a radon cure in Germany is given by the individual health resorts as about one to two millisieverts, depending on the location. In 2010, doctors in Erlangen, using the (outdated) LNT (Linear, No-Threshold) model, concluded that five percent of all lung cancer deaths in Germany are caused by radon.
Sources: en.wikipedia.org
Reversed-phase high-performance liquid chromatography with ultraviolet detection at 214 nanometres is the usual approach. Peak area percentage provides a purity figure relative to other components in the sample. Mass spectrometry is then applied to confirm identity.
Aspartate can cyclise into a succinimide intermediate that later hydrolyses back as isoaspartate. Both forms share the same molecular mass, so mass spectrometry alone cannot tell them apart. This shapes how purity data should be interpreted.
Freeze-dried material is normally kept desiccated below minus twenty degrees Celsius and shielded from light. Solutions are prepared shortly before use and held cold. Repeated thawing is avoided because it accelerates aggregation and degradation.
No. Epithalamin is a heterogeneous peptide fraction obtained from pineal gland extract and contains many components. Epitalon is a single synthetic tetrapeptide with the sequence Ala-Glu-Asp-Gly. Researchers synthesised the shorter peptide while attempting to identify active sequences within the extract.